Input -version 0.4.0- | Primer3
PRIMER_PICK_LEFT_INPUT=200 PRIMER_PICK_RIGHT_INPUT=400 PRIMER_PRODUCT_SIZE_RANGE=150-250 Version 0.4.0 respects standard thermodynamic calculations (nearest-neighbor).
PRIMER_PICK_LEFT_INPUT=1 # Start of left primer search region PRIMER_PICK_RIGHT_INPUT=500 # End of right primer search region To force primers to flank a specific SNP or target: primer3 input -version 0.4.0-
PRIMER_MAX_MISPRIMING=12.0 PRIMER_MAX_END_MISPRIMING=6.0 PRIMER_NUM_RETURN=5 Running Primer3 v0.4.0 Save your input as input.txt . Then run: For highly repetitive targets
PRIMER_MISPRIMING_LIBRARY=/path/to/human_repeat_masked.lib PRIMER_MAX_MISPRIMING=12.00 # Maximum allowed mispriming score PRIMER_MAX_END_MISPRIMING=6.00 # Max mispriming score in last 5 bases : The mispriming scoring is more stringent. For highly repetitive targets, increase PRIMER_MAX_MISPRIMING to 15.0 . 6. Product Size Control PRIMER_PRODUCT_SIZE_RANGE=100-300 PRIMER_PRODUCT_OPT_SIZE=200 7. Internal Oligo (Probe) Parameters If PRIMER_TASK=pick_detection_primers , you can specify probe constraints. primer3 input -version 0.4.0-
PRIMER_OPT_SIZE=20 PRIMER_MIN_SIZE=18 PRIMER_MAX_SIZE=27 PRIMER_OPT_TM=60.0 PRIMER_MIN_TM=57.0 PRIMER_MAX_TM=63.0 PRIMER_MAX_DIFF_TM=3.0 Avoid 3' instability and low-complexity regions.
SEQUENCE=AGCTAGCTACGATCGATTCGATCGATCGATCGATCG Specify where primers can bind. Coordinates are 1-based.
Designing reliable PCR primers is a cornerstone of molecular biology. While Primer3 has been the industry standard for decades, its command-line interface—specifically the input formatting—can be daunting. This article focuses on Primer3 version 0.4.0 , explaining how to structure your input file to leverage the full power of this release. The Core Syntax: Key-Value Pairs Primer3 v0.4.0 uses a simple, line-oriented, key-value pair format. Every input file must end with a blank line followed by a line containing only = .